pY026
(Plasmid #84741)

• Purpose: Expresses huAsCpf1 and crRNA guide
• Depositing Lab: Feng Zhang
• Publication: Zetsche et al Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 4963
• Total vector size (bp): 9767
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: huAsCpf1
• Alt name: AsCas12a
• Species: Synthetic
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Synthesized by GenScript
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains a BsmBI cloning cassette for U6 driven crRNA expression.