pY109 (lenti-LbCpf1)
(Plasmid #84740)

• Purpose: Lenti virus delivery of LbCpf1 and crRNA guide
• Depositing Lab: Feng Zhang
• Publication: Zetsche et al Nat Biotechnol. 2017 Jan;35(1):31-34. doi: 10.1038/nbt.3737. Epub 2016 Dec 5.

Backbone

• Vector backbone: pHKO_23
• Backbone size w/o insert (bp): 8069
• Total vector size (bp): 12630
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: huLbCpf1
• Alt name: huLbCas12a
• Species: Synthetic
• Insert Size (bp): 3867
• Promoter: EFS
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aggtcttgaaaggagtgggaattgg

Gene/Insert 2

• Gene/Insert name: puromycin resistance gene
• Alt name: puro
• Species: Synthetic
• Insert Size (bp): 597
• Tag / Fusion Protein:
  • P2A (N terminal on insert)

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains a BsmBI cloning cassette for insertion of Cpf1 guides under U6 promoter control.