pUB-nSypHer (NLS:sypHer:NLS)
(Plasmid
#84731)
-
PurposeExpresses sypHer in plant cells-biosensor for pH targeted to Nuclei
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUB-DEST
-
Backbone manufacturerGrefen et al. The Plant Journal (2010) 64, 355–365
- Backbone size w/o insert (bp) 9210
- Total vector size (bp) 10647
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenSypHer
-
Insert Size (bp)1476
- Promoter ubiqutin- 10 gene promoter (pUBQ10) of Arabidopsis
-
Tags
/ Fusion Proteins
- NLS (nuclear localisation signal) (N terminal on insert)
- NLS (nuclear localisation signal (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGATTTTCTGGGTTTGATCGTT
- 3′ sequencing primer AGGTCACTGGATTTTGGTTTTAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUB-nSypHer (NLS:sypHer:NLS) was a gift from Philip Mullineaux (Addgene plasmid # 84731 ; http://n2t.net/addgene:84731 ; RRID:Addgene_84731) -
For your References section:
Photosynthesis-dependent H2O2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism. Exposito-Rodriguez M, Laissue PP, Yvon-Durocher G, Smirnoff N, Mullineaux PM. Nat Commun. 2017 Jun 29;8(1):49. doi: 10.1038/s41467-017-00074-w. 10.1038/s41467-017-00074-w [pii] PubMed 28663550