pMyBADC-kan
(Plasmid #84689)

• Purpose: (Empty Backbone) Protein expression in mycobacteria
• Depositing Lab: Matthias Wilmanns
• Publication: Beckham et al Protein Sci. 2020 Oct 2. doi: 10.1002/pro.3962.

Backbone

• Vector backbone: pMyC-kan
• Backbone manufacturer: Wilmanns lab
• Backbone size (bp): 6811
• Modifications to backbone: The acetamidase-inducible promoter in pMyC-kan was replaced by the E. coli arabinose-inducible promoter from pBADM11 vector. The pMyC-kan backbone was amplified using the primers: 5’-ccatgggctcggccg and 5’-gaccgcgtcacttctttatctagatttaaagatc. The arabinose-inducible promoter from the pBAD vector was amplified using the primers: 5’-agaagtgacgcggtcctagattatgacaacttgacggctacatcattcactttttct and 5’-cggccgagcccatggggttaattcctcctgttagcccaaaaaacggg.
• Vector type: Bacterial Expression
• Promoter: AraC
• Tag / Fusion Protein:
  • His6 (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTGACGCTTTTTATCGCAACTC
• 3′ sequencing primer: TTGATGACGAGCGTAATGGC

Resource Information

• Supplemental Documents:
  • pMyBADC-kan.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry