pGEX6P1-GST-Laforin C250S
(Plasmid
#84679)
-
Purposebacterial expression, GST-fusion protein
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGEX6P1
- Backbone size w/o insert (bp) 4900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLaforin
-
SpeciesH. sapiens (human)
-
Entrez GeneEPM2A (a.k.a. EPM2, MELF)
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene Sanger sequencing results found extra YSSGRIVTD at C-term of Laforin
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1-GST-Laforin C250S was a gift from Ayano Satoh (Addgene plasmid # 84679 ; http://n2t.net/addgene:84679 ; RRID:Addgene_84679) -
For your References section:
S-nitrosylation of laforin inhibits its phosphatase activity and is implicated in Lafora disease. Toyota R, Honjo Y, Imajo R, Satoh A. Sciencematters 10.19185/matters.201606000014