Skip to main content
Addgene

pQCXIP-Laforin Myc 3CS (C250S,C266S,C278S)
(Plasmid #84661)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84661 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pQCXIP
  • Total vector size (bp) 7200
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Laforin
  • Species
    H. sapiens (human)
  • Entrez Gene
    EPM2A (a.k.a. EPM2, MELF)
  • Promoter 5'LTR
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCCATCCACGCTGTTTTGAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIP-Laforin Myc 3CS (C250S,C266S,C278S) was a gift from Ayano Satoh (Addgene plasmid # 84661 ; http://n2t.net/addgene:84661 ; RRID:Addgene_84661)

  • For your References section:

    S-nitrosylation of laforin inhibits its phosphatase activity and is implicated in Lafora disease. Toyota R, Honjo Y, Imajo R, Satoh A. Sciencematters 10.19185/matters.201606000014
Related items: