Skip to main content
Addgene

pSLIK CA ROCK2
(Plasmid #84649)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84649 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSLIK
  • Backbone manufacturer
    Iain Fraser (Addgene plasmid # 25734)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Venus; Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ROCK2
  • Species
    B. taurus (bovine)
  • Mutation
    Constitutive Active (please see depositor comments below)
  • Entrez Gene
    ROCK2 (a.k.a. ROCK-II)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
  • 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert contains Y71C, R77K, F184Y, Y199F, R263K, H274N, R343K, T345N, N372T, M374T, T394V, S407N, AND A411T mutations and premature truncation (ends at amino acid 468) compared to reference sequence (NP001308572.1). The depositor states that these mutations do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK CA ROCK2 was a gift from Sanjay Kumar (Addgene plasmid # 84649 ; http://n2t.net/addgene:84649 ; RRID:Addgene_84649)

  • For your References section:

    Constitutive activation of myosin-dependent contractility sensitizes glioma tumor-initiating cells to mechanical inputs and reduces tissue invasion. Wong SY, Ulrich TA, Deleyrolle LP, MacKay JL, Lin JM, Martuscello RT, Jundi MA, Reynolds BA, Kumar S. Cancer Res. 2015 Mar 15;75(6):1113-22. doi: 10.1158/0008-5472.CAN-13-3426. Epub 2015 Jan 29. 10.1158/0008-5472.CAN-13-3426 PubMed 25634210
Related items:
Commonly requested with: