pSLIK DN RhoA
(Plasmid #84646)

• Purpose: Lentiviral expression of doxycycline-inducible dominant negative RhoA and co-expression of Venus
• Depositing Lab: Sanjay Kumar
• Publication: MacKay et al Integr Biol (Camb). 2014 Sep;6(9):885-94. doi: 10.1039/c4ib00099d.

Backbone

• Vector backbone: pSLIK
• Backbone manufacturer: Iain Fraser (Addgene plasmid # 25734)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Venus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RhoA
• Species: H. sapiens (human)
• Mutation: Dominant Negative
• Entrez Gene: RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
• Tag / Fusion Protein:
  • Myc (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: pTYF-5 GTAGACATAATAGCAACAGAC
• 3′ sequencing primer: hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert contains T19N in RhoA insert compared to best match reference sequence (NP_001655.1)