pSLIK DN Rac1
(Plasmid #84642)

• Purpose: Lentiviral expression of doxycycline-inducible dominant negative Rac1 and co-expression of Venus
• Depositing Lab: Sanjay Kumar
• Publication: MacKay et al Integr Biol (Camb). 2014 Sep;6(9):885-94. doi: 10.1039/c4ib00099d.

Backbone

• Vector backbone: pSLIK
• Backbone manufacturer: Iain Fraser (Addgene plasmid # 25734)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Venus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Rac1
• Species: H. sapiens (human)
• Mutation: Dominant Negative
• Entrez Gene: RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: pTYF-5 GTAGACATAATAGCAACAGAC
• 3′ sequencing primer: hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insert contains T17N mutation compared to best match reference sequence (NP_008839.2). The depositor states that this mutation does not affect plasmid function.