F5A deltaCT S6K1 MSCV puro
(Plasmid #8464)

• Depositing Lab: David Sabatini
• Publication: Ali et al J Biol Chem 2005 Apr 4;.

Backbone

• Vector backbone: mscv puro
• Backbone manufacturer: bd biosciences
• Backbone size w/o insert (bp): 6300
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: f5a delta ctp70 S6K1
• Alt name: p70S6K1
• Alt name: f5a delta ct 104
• Alt name: delta 104
• Species: R. norvegicus (rat)
• Insert Size (bp): 1200
• Mutation: deletion of 104 c-terminal amino acids mutation of F to A at 5
• Entrez Gene: Rps6kb1 (a.k.a. p70 S6K-alpha)
• Tag / Fusion Protein:
  • myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: sal (not destroyed)
• 3′ cloning site: not (not destroyed)
• 5′ sequencing primer: mscv (CCCTTGAACCTCCTCGTTCGACC)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: joe avruch

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry