pCRISPRyl_D17
(Plasmid
#84611)
-
PurposeIntroduces DSB at D17 locus in Y. lipolytica
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84611 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2623
- Total vector size (bp) 11822
-
Vector typeYeast Expression, CRISPR, Synthetic Biology
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
gRNA/shRNA sequenceTCCGTAATATAGGTGACGAC
- Promoter UAS1B8-TEF(136)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BssHII (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TEF
- 3′ sequencing primer CYC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene material #44380 (UAS1B8-TEF promoter) is used to express Cas9
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRyl_D17 was a gift from Ian Wheeldon (Addgene plasmid # 84611 ; http://n2t.net/addgene:84611 ; RRID:Addgene_84611) -
For your References section:
Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. Schwartz C, Shabbir-Hussain M, Frogue K, Blenner M, Wheeldon I. ACS Synth Biol. 2016 Dec 19. 10.1021/acssynbio.6b00285 PubMed 27989123