Skip to main content
Addgene

pEGFP-PH-SWAP70(R223E, R224E)
(Plasmid #84583)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84583 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SWAP70 residues 209-306 with mutations R223E and R224E
  • Alt name
    SWP70, KIAA0640, HSPC321
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    310
  • Mutation
    Pleckstrin-homology domain, residues 209-306, mutations R223E and R224E
  • GenBank ID
    NM_001297714.1
  • Entrez Gene
    SWAP70 (a.k.a. HSPC321, SWAP-70)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCCGCCGGGATCAC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-PH-SWAP70(R223E, R224E) was a gift from Geert van den Bogaart (Addgene plasmid # 84583 ; http://n2t.net/addgene:84583 ; RRID:Addgene_84583)
  • For your References section:

    SWAP70 Organizes the Actin Cytoskeleton and Is Essential for Phagocytosis. Baranov MV, Revelo NH, Dingjan I, Maraspini R, Ter Beest M, Honigmann A, van den Bogaart G. Cell Rep. 2016 Nov 1;17(6):1518-1531. doi: 10.1016/j.celrep.2016.10.021. 10.1016/j.celrep.2016.10.021 PubMed 27806292