pEGFP-SWAP70
(Plasmid
#84581)
-
PurposeExpresses GFP-tagged SWAP70 in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSWAP70
-
Alt nameSWP70, KIAA0640, HSPC321
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1774
-
GenBank IDNM_001297714.1
-
Entrez GeneSWAP70 (a.k.a. HSPC321, SWAP-70)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCCGCCGGGATCAC
- 3′ sequencing primer CCTCTACAAATGTGGTATGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-SWAP70 was a gift from Geert van den Bogaart (Addgene plasmid # 84581 ; http://n2t.net/addgene:84581 ; RRID:Addgene_84581) -
For your References section:
SWAP70 Organizes the Actin Cytoskeleton and Is Essential for Phagocytosis. Baranov MV, Revelo NH, Dingjan I, Maraspini R, Ter Beest M, Honigmann A, van den Bogaart G. Cell Rep. 2016 Nov 1;17(6):1518-1531. doi: 10.1016/j.celrep.2016.10.021. 10.1016/j.celrep.2016.10.021 PubMed 27806292