Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Twist-siRNA7
(Plasmid #8457)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 8457 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSP-108
  • Backbone size w/o insert (bp) 9439
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    siTwist
  • Alt name
    siRNA Twist
  • Alt name
    mTwist
  • Alt name
    Twist
  • Species
    M. musculus (mouse)
  • GenBank ID
    M63649
  • Entrez Gene
    Twist1 (a.k.a. M-Twist, Pde, Ska10, Ska<m10Jus>, Twist, bHLHa38, pdt)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer na
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Empty pSP108 vector can be obtained from Dr. Eric Fearson, Univ of Michigan

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Twist-siRNA7-targetting sequence is AGCGGGTCATGGCTAACGTGC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Twist-siRNA7 was a gift from Bob Weinberg (Addgene plasmid # 8457 ; http://n2t.net/addgene:8457 ; RRID:Addgene_8457)
  • For your References section:

    Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Yang J, Mani SA, Donaher JL, Ramaswamy S, Itzykson RA, Come C, Savagner P, Gitelman I, Richardson A, Weinberg RA. Cell 2004 Jun 25;117(7):927-39. 10.1016/j.cell.2004.06.006 PubMed 15210113