Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCLHCX-mPM20D1-flag
(Plasmid #84566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84566 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCLNCX
  • Backbone manufacturer
    Novus Bio
  • Backbone size w/o insert (bp) 9400
  • Total vector size (bp) 11000
  • Modifications to backbone
    Neo resistance changed to hygro, BamHI before second CMV is destroyed, between HindIII and XhoI is inserted [MluI, BglII, AgeI, BamHI, flag, NotI, 6xHis], WPRE inserted between XhoI and ClaI
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    peptidase M20 domain containing 1
  • Alt name
    PM20D1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1600
  • GenBank ID
    NM_178079.3
  • Entrez Gene
    Pm20d1 (a.k.a. 4732466D17Rik, AI098026)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Flag (C terminal on backbone)
    • 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer GAGCTCGTTTAGTGAACCGTC
  • 3′ sequencing primer GGCATTAAAGCAGCGTATCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCLHCX-mPM20D1-flag was a gift from Bruce Spiegelman (Addgene plasmid # 84566 ; http://n2t.net/addgene:84566 ; RRID:Addgene_84566)
  • For your References section:

    The Secreted Enzyme PM20D1 Regulates Lipidated Amino Acid Uncouplers of Mitochondria. Long JZ, Svensson KJ, Bateman LA, Lin H, Kamenecka T, Lokurkar IA, Lou J, Rao RR, Chang MR, Jedrychowski MP, Paulo JA, Gygi SP, Griffin PR, Nomura DK, Spiegelman BM. Cell. 2016 Jul 14;166(2):424-35. doi: 10.1016/j.cell.2016.05.071. Epub 2016 Jun 30. 10.1016/j.cell.2016.05.071 PubMed 27374330