Rap-MESA-20-M-Gal4
(Plasmid
#84554)
-
PurposeMESA target chain with rapamycin FRB ectodomain, 20 extracellular linkers, M cleavage sequence, and Gal4 transactivator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5520
- Total vector size (bp) 6844
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRap-MESA-FRB-20-M-Gal4
-
Insert Size (bp)1326
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rap-MESA-20-M-Gal4 was a gift from Joshua Leonard (Addgene plasmid # 84554 ; http://n2t.net/addgene:84554 ; RRID:Addgene_84554) -
For your References section:
Multiplexing Engineered Receptors for Multiparametric Evaluation of Environmental Ligands. Hartfield RM, Schwarz KA, Muldoon JJ, Bagheri N, Leonard JN. ACS Synth Biol. 2017 Nov 17;6(11):2042-2055. doi: 10.1021/acssynbio.6b00279. Epub 2017 Aug 23. 10.1021/acssynbio.6b00279 PubMed 28771312