Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pT2U2T2-YFP
(Plasmid #84549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84549 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBI
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3722
  • Total vector size (bp) 4699
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    T2U2T2-EYFP
  • Species
    Synthetic
  • Insert Size (bp)
    989
  • Promoter CMV-min

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer gcaatagcatcacaaatttc
  • 3′ sequencing primer cccataatttttggcagagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT2U2T2-YFP was a gift from Joshua Leonard (Addgene plasmid # 84549 ; http://n2t.net/addgene:84549 ; RRID:Addgene_84549)
  • For your References section:

    Multiplexing Engineered Receptors for Multiparametric Evaluation of Environmental Ligands. Hartfield RM, Schwarz KA, Muldoon JJ, Bagheri N, Leonard JN. ACS Synth Biol. 2017 Nov 17;6(11):2042-2055. doi: 10.1021/acssynbio.6b00279. Epub 2017 Aug 23. 10.1021/acssynbio.6b00279 PubMed 28771312