V2-MESA-35F-Tev-MS2-p65-HSF1
(Plasmid #84513)

• Purpose: MESA protease chain with V2-MESA ectodomain, 35 extracellular linkers, a flag tag, and Tev protease, MS2-P65-HSF1
• Depositing Lab: Joshua Leonard
• Publication: Schwarz et al Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253.

Backbone

• Vector backbone: pGIPZ
• Backbone manufacturer: Open Biosystems
• Backbone size w/o insert (bp): 9213
• Total vector size (bp): 14135
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: V2-MESA-35F-Tev
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1587
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CAAAAGACGGCAATATGGTGG

Gene/Insert 2

• Gene/Insert name: MS2-P65-HSF1
• Species: Synthetic
• Insert Size (bp): 1419
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: GGACGTGGTTTTCCTTTG
• 3′ sequencing primer: GTTTTTCTAGGTCTCGACTGCAG

Resource Information

• Supplemental Documents:
  • V2-MESA-35F-Tev-MS2-p65-HSF1.gb
• A portion of this plasmid was derived from a plasmid made by: MS2-P65-HSF1 obtained from Feng Zhang lab at MIT (plasmid lenti MS2-P65-HSF1_Hygro - Addgene# 61426)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry