V1-MESA-45F-M-dCas9
(Plasmid #84504)

• Purpose: MESA target chain with V1-MESA ectodomain, 45 extracellular linkers, a flag tag, M cleavage sequence, and dCas9-VP64
• Depositing Lab: Joshua Leonard
• Publication: Schwarz et al Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253.

Backbone

• Vector backbone: pGIPZ
• Backbone manufacturer: Open Biosystems
• Backbone size w/o insert (bp): 9213
• Total vector size (bp): 15318
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: V2-MESA-35F-M-dCas9
• Species: H. sapiens (human); S. pyogenes
• Insert Size (bp): 5373
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CATGTTAGCAGACTTCCTC

Resource Information

• Supplemental Documents:
  • V1-MESA-45F-M-dCas9.gb
• A portion of this plasmid was derived from a plasmid made by: dCas9 was obtained from Feng Zhang lab at MIT (lenti dCAS-VP64_Blast - Addgene# 61425)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry