V1-MESA-45F-Tev
(Plasmid
#84501)
-
PurposeMESA protease chain with V1-MESA ectodomain, 45 extracellular linkers, a flag tag, and Tev protease
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5520
- Total vector size (bp) 7194
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameV1-MESA-45F-Tev
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1674
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V1-MESA-45F-Tev was a gift from Joshua Leonard (Addgene plasmid # 84501 ; http://n2t.net/addgene:84501 ; RRID:Addgene_84501) -
For your References section:
Rewiring human cellular input-output using modular extracellular sensors. Schwarz KA, Daringer NM, Dolberg TB, Leonard JN. Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253. 10.1038/nchembio.2253 PubMed 27941759