-
PurposepJB38-NWMN29-30+ SarA_P1-mAmetrine-Term
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84464 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepJB38-NWMN2930
- Backbone size w/o insert (bp) 8815
- Total vector size (bp) 9948
-
Vector typeSynthetic Biology
-
Selectable markersalso contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E.coli DC10b (described in doi: 10.1128/mBio.00537-12)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSarA_P1-mAmetrine from pRN12
-
Insert Size (bp)1133
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer CATAATGTGTTGTAAACATTTTTTTTG
- 3′ sequencing primer TATGTCACTTATCCTTTTGGAAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRN112 was a gift from Reindert Nijland (Addgene plasmid # 84464 ; http://n2t.net/addgene:84464 ; RRID:Addgene_84464) -
For your References section:
Fluorescent reporters for markerless genomic integration in Staphylococcus aureus. de Jong NW, van der Horst T, van Strijp JA, Nijland R. Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889. 10.1038/srep43889 PubMed 28266573
Map uploaded by the depositor.
