Skip to main content
Addgene

pJB38-NWMN2930
(Plasmid #84457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84457 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJB38
  • Backbone size w/o insert (bp) 7015
  • Total vector size (bp) 8815
  • Selectable markers
    also contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10F
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Staphylococcus aureus NWMN genomic region NWMN29-30
  • Species
    Staphylocccus aureus
  • GenBank ID
    NC_009641.1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer AACCTATAAAAATAGGCGTATCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB38-NWMN2930 was a gift from Reindert Nijland (Addgene plasmid # 84457 ; http://n2t.net/addgene:84457 ; RRID:Addgene_84457)
  • For your References section:

    Fluorescent reporters for markerless genomic integration in Staphylococcus aureus. de Jong NW, van der Horst T, van Strijp JA, Nijland R. Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889. 10.1038/srep43889 PubMed 28266573