pRN10
(Plasmid #84454)

• Purpose: shuttle plasmid for sarA P1-mKate expression
• Depositing Lab: Reindert Nijland
• Publication: de Jong et al Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889.

Backbone

• Vector backbone: pCM29
• Backbone size w/o insert (bp): 6604
• Total vector size (bp): 6559
• Modifications to backbone: sGFP replaced with insert
• Vector type: shuttle vector E.coli-S.aureus, expression of sGFP from the SarA-P1 promoter
• Selectable markers: also contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): E.coli DC10b (described in doi: 10.1128/mBio.00537-12)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mKate2
• Species: Synthetic
• Insert Size (bp): 716

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: xmai (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TTGCATGCCTGCAGGTCGACTCTA
• 3′ sequencing primer: TTATGCTTCCGGCTCGTATGTTGTGTGG

Resource Information

• Supplemental Documents:
  • pRN10_mKate.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: mKate2 gene amplified from genomic DNA of S. pneumonia strain MK119 , described in Kjos M, Veening J-W. 2014. Tracking of chromosome dynamics in live Streptococcus pneumoniae reveals that transcription promotes chromosome segregation. Molecular Microbiology 91:1088-1105.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry