pTH3
(Plasmid #84453)

• Purpose: shuttle plasmid for sarA P1-YFP expression
• Depositing Lab: Reindert Nijland
• Publication: de Jong et al Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889.

Backbone

• Vector backbone: pCM29
• Backbone size w/o insert (bp): 6604
• Total vector size (bp): 6580
• Modifications to backbone: sGFP replaced with insert
• Vector type: shuttle vector E.coli-S.aureus, expression of sGFP from the SarA-P1 promoter
• Selectable markers: also contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10F
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YFP venus
• Insert Size (bp): 737

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: kpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TTGCATGCCTGCAGGTCGACTCTA
• 3′ sequencing primer: TTATGCTTCCGGCTCGTATGTTGTGTGG

Resource Information

• Supplemental Documents:
  • pTH3.gb
• A portion of this plasmid was derived from a plasmid made by: YFP / Venus amplified from pJL77; Liese J, Rooijakkers SHM, van Strijp JAG, Novick RP, Dustin ML. 2013. Intravital two-photon microscopy of host–pathogen interactions in a mouse model of Staphylococcus aureus skin abscess formation. Cellular microbiology 15:891.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry