pTH1
(Plasmid #84451)

• Purpose: shuttle plasmid for sarA P1-dsRED expression
• Depositing Lab: Reindert Nijland
• Publication: de Jong et al Sci Rep. 2017 Mar 7;7:43889. doi: 10.1038/srep43889.

Backbone

• Vector backbone: pCM29
• Backbone size w/o insert (bp): 6604
• Total vector size (bp): 6537
• Modifications to backbone: sGFP replaced with insert
• Vector type: shuttle vector E.coli-S.aureus, expression of sGFP from the SarA-P1 promoter
• Selectable markers: also contains Chloramphenicol resistance gene, but only functional in Gram-postive bacteria.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10F
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DsRed.T3(DNT)
• Insert Size (bp): 694

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: kpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TTGCATGCCTGCAGGTCGACTCTA
• 3′ sequencing primer: TTATGCTTCCGGCTCGTATGTTGTGTGG

Resource Information

• Supplemental Documents:
  • pTH1.gb
• A portion of this plasmid was derived from a plasmid made by: DsRED gene amplified from plasmid pKTEI; Dunn AK, Millikan DS, Adin DM, Bose JL, Stabb EV. 2006. New rfp- and pES213-Derived Tools for Analyzing Symbiotic Vibrio fischeri Reveal Patterns of Infection and lux Expression In Situ. Applied and environmental microbiology 72:802-810.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry