pEpic_Lite
(Plasmid #84373)

• Purpose: (Empty Backbone) 3rd-generation lentiviral destination vector for gateway cloning
• Depositing Lab: Philip Washbourne
• Publication: Fowler et al PLoS One. 2016 Aug 8;11(8):e0159277. doi: 10.1371/journal.pone.0159277. eCollection 2016.

Backbone

• Vector backbone: pEpic
• Backbone size (bp): 7992
• Modifications to backbone: pEpic_Lite was created by removing the PuroR cassette by AgeI/ApaI restriction enzyme digestion, filling in 5’ overhangs with DNA polymerase I Klenow fragment, and blunt-end ligation with T4 DNA ligase.
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pTYF-5 (GTAGACATAATAGCAACAGAC)
• 3′ sequencing primer: WPRE-R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry