pEpic
(Plasmid #84372)

• Purpose: (Empty Backbone) 3rd-generation lentiviral destination vector for gateway cloning with puromycin resistance.
• Depositing Lab: Kryn Stankunas
• Publication: Fowler et al PLoS One. 2016 Aug 8;11(8):e0159277. doi: 10.1371/journal.pone.0159277. eCollection 2016.

Backbone

• Vector backbone: pLenti PGK PURO DEST (Addgene 19068)
• Backbone size (bp): 9093
• Modifications to backbone: pEpic was made by blunt-end cloning the XhoI/ClaI-defined attR4-attR3 cassette from pDestTol2pA2 into the 7.3kb EcoRV fragment of pLenti PGK PURO DEST, effectively replacing its attR1-attR2 cassette.
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Growth instructions: May take up to 48 hr for single colonies to form on plates.
• Copy number: Unknown

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pTYF-5 (GTAGACATAATAGCAACAGAC)
• 3′ sequencing primer: WPRE-R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry