Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAd-Track Control siRNA
(Plasmid #8437)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 8437 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAd-Track
  • Backbone size (bp) 8320
  • Modifications to backbone
    Point mutation in SIRT1 siRNA
  • Vector type
    Mammalian Expression, Adenoviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Control siRNA
  • Insert Size (bp)
    200

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn I (not destroyed)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer No
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Target sequence: GATGAAGTCGACCTCCTCAT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAd-Track Control siRNA was a gift from Pere Puigserver (Addgene plasmid # 8437 ; http://n2t.net/addgene:8437 ; RRID:Addgene_8437)
  • For your References section:

    Nutrient control of glucose homeostasis through a complex of PGC-1alpha and SIRT1. Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM, Puigserver P. Nature 2005 Mar 3;434(7029):113-8. 10.1038/nature03354 PubMed 15744310