mCm7RNA6A
(Plasmid
#84367)
-
PurposeCas9-gRNA plasmid for mouse Cbfa2t2 m7 mutant knockin
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 48138)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCbfa2t2 m7-gRNA6
-
gRNA/shRNA sequenceAGAGAAAACTAGGCGCTCCA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer hU6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCm7RNA6A was a gift from Danny Reinberg (Addgene plasmid # 84367 ; http://n2t.net/addgene:84367 ; RRID:Addgene_84367) -
For your References section:
Co-repressor CBFA2T2 regulates pluripotency and germline development. Tu S, Narendra V, Yamaji M, Vidal SE, Rojas LA, Wang X, Kim SY, Garcia BA, Tuschl T, Stadtfeld M, Reinberg D. Nature. 2016 Jun 8;534(7607):387-90. doi: 10.1038/nature18004. 10.1038/nature18004 PubMed 27281218