AAV-FLEX-CAG-CyRFP1
(Plasmid #84357)

• Purpose: Expresses CyRFP1 fluorescent protein in an AAV backbone, FLEX version (Cre dependent)
• Depositing Lab: Ryohei Yasuda
• Publication: Laviv et al Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4046.

Backbone

• Vector backbone: pAAV-CAG-FLEX
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 5700
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Preferable to grow at 30 deg, prone for recombination
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CyRFP1
• Species: Synthetic
• Insert Size (bp): 700
• Mutation: Double FLEXed
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (Inverted 5') (not destroyed)
• 3′ cloning site: AscI (Inverted 3') (not destroyed)
• 5′ sequencing primer: gcaacgtgctggttattgtg
• 3′ sequencing primer: GATAAGCTTGATATCGAATTC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry