Skip to main content
Addgene

pTWIN1-His6-Ssp-Httex1-15Q
(Plasmid #84348)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84348 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTWIN1
  • Backbone manufacturer
    eBioLabs
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 6530
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Huntingtin Exon1
  • Alt name
    Httex1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    730
  • Entrez Gene
    HTT (a.k.a. HD, IT15, LOMARS)
  • Promoter T7
  • Tag / Fusion Protein
    • N-terminal Ssp intein (His-tagged)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The company GeneArt from Thermo Fisher Scientific performed the synthesis and subcloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTWIN1-His6-Ssp-Httex1-15Q was a gift from Hilal Lashuel (Addgene plasmid # 84348 ; http://n2t.net/addgene:84348 ; RRID:Addgene_84348)

  • For your References section:

    An Intein-based Strategy for the Production of Tag-free Huntingtin Exon 1 Proteins Enables New Insights into the Polyglutamine Dependence of Httex1 Aggregation and Fibril Formation. Vieweg S, Ansaloni A, Wang ZM, Warner JB, Lashuel HA. J Biol Chem. 2016 Jun 3;291(23):12074-86. doi: 10.1074/jbc.M116.713982. Epub 2016 Mar 21. 10.1074/jbc.M116.713982 PubMed 27002149
Related items:
Commonly requested with: