pTWIN1-His6-Ssp-Httex1-7Q
(Plasmid #84347)

• Purpose: Expression of the human Huntingtin Exon1 protein containing 7Q in E.coli
• Depositing Lab: Hilal Lashuel
• Publication: Vieweg et al J Biol Chem. 2016 Jun 3;291(23):12074-86. doi: 10.1074/jbc.M116.713982. Epub 2016 Mar 21.

Backbone

• Vector backbone: pTWIN1
• Backbone manufacturer: eBioLabs
• Backbone size w/o insert (bp): 5800
• Total vector size (bp): 6500
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Huntingtin Exon 1
• Alt name: Httex1
• Species: H. sapiens (human)
• Insert Size (bp): 700
• Entrez Gene: HTT (a.k.a. HD, IT15, LOMARS)
• Promoter: T7
• Tag / Fusion Protein:
  • N-terminal His6-tagged intein Ssp

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGG
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The company GeneArt from Thermo Fisher Scientific performed the synthesis and subcloning
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry