pCMV6M-Mst2
(Plasmid
#84296)
-
PurposeExpresses Myc-tagged Mst2
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV6
- Backbone size w/o insert (bp) 4746
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMst2
-
Alt nameStk3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2000
-
Entrez GeneSTK3 (a.k.a. KRS1, MST2)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer gtgtacggtgggaggtctatataa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Myc-tagged Mst2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6M-Mst2 was a gift from Jonathan Chernoff (Addgene plasmid # 84296 ; http://n2t.net/addgene:84296 ; RRID:Addgene_84296) -
For your References section:
H-ras Inhibits the Hippo Pathway by Promoting Mst1/Mst2 Heterodimerization. Rawat SJ, Araiza-Olivera D, Arias-Romero LE, Villamar-Cruz O, Prudnikova TY, Roder H, Chernoff J. Curr Biol. 2016 Jun 20;26(12):1556-63. doi: 10.1016/j.cub.2016.04.027. Epub 2016 May 26. 10.1016/j.cub.2016.04.027 PubMed 27238285