pEGFP-Merlin
(Plasmid #84293)

• Purpose: Expression of wt Merlin
• Depositing Lab: Jonathan Chernoff
• Publication: Xiao et al J Biol Chem. 2002 Jan 11. 277(2):883-6.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4731
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Merlin (NF2)
• Species: H. sapiens (human)
• Entrez Gene: NF2 (a.k.a. ACN, BANF, SCH, SWNV, merlin-1)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

WT Merlin