pLdCH
(Plasmid
#84291)
-
PurposeExpress gRNA and Cas9 in Leishmania with Hygromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSP72
- Total vector size (bp) 9358
-
Vector typeCRISPR ; Leishmania
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA and Cas9
-
gRNA/shRNA sequencenew gRNA guide
-
SpeciesLeishmania
- Promoter L. donovani ribosome RNA promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs I (not destroyed)
- 3′ cloning site Bbs I (not destroyed)
- 5′ sequencing primer CATATGTGAGTTATGAGGTCTGCGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypX330-U6-Chimeric_BB- CBh-hSpCas9 Obtained from Brodt Institute (through Addgene)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This Leishmania CRISPR vector co-express gRNA and Cas9 with Hygromycin resistance. It can also be used to express dual, triple or more gRNAs simultaneously with Cas9.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLdCH was a gift from Greg Matlashewski (Addgene plasmid # 84291 ; http://n2t.net/addgene:84291 ; RRID:Addgene_84291) -
For your References section:
Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. Zhang WW, Lypaczewski P, Matlashewski G. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb. mSphere00340-16 [pii] PubMed 28124028