Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
(Plasmid #84260)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84260 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Total vector size (bp) 9086
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Sp sgSV40
  • Alt name
    sgRNA sequence: GAAAGTCCCCAGGCTCCCCAGC
  • Species
    Synthetic; S. pyogenes
  • Promoter mouse U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
  • 3′ sequencing primer ATGCATGGCGGTAATACGGTTAT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PYL1-KRAB
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    804
  • Promoter CMV
  • Tags / Fusion Proteins
    • PYL1 (N terminal on insert)
    • IRES-mCherry (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gctaccatgggtgggggcgcgc
  • 3′ sequencing primer gacggcaatatggtggaaaataac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The PYL1 domain was a gift from Jerry Crabtree (Stanford).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry was a gift from Stanley Qi (Addgene plasmid # 84260 ; http://n2t.net/addgene:84260 ; RRID:Addgene_84260)
  • For your References section:

    Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111