pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
(Plasmid
#84260)
-
PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
- Total vector size (bp) 9086
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSp sgSV40
-
Alt namesgRNA sequence: GAAAGTCCCCAGGCTCCCCAGC
-
SpeciesSynthetic; S. pyogenes
- Promoter mouse U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (destroyed during cloning)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
- 3′ sequencing primer ATGCATGGCGGTAATACGGTTAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePYL1-KRAB
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)804
- Promoter CMV
-
Tags
/ Fusion Proteins
- PYL1 (N terminal on insert)
- IRES-mCherry (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gctaccatgggtgggggcgcgc
- 3′ sequencing primer gacggcaatatggtggaaaataac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe PYL1 domain was a gift from Jerry Crabtree (Stanford).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry was a gift from Stanley Qi (Addgene plasmid # 84260 ; http://n2t.net/addgene:84260 ; RRID:Addgene_84260) -
For your References section:
Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111