Skip to main content
Addgene

pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP
(Plasmid #84254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84254 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Total vector size (bp) 7648
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sa sgCXCR4-1
  • gRNA/shRNA sequence
    GCAGACGCGAGGAAGGAGGGCGC
  • Species
    H. sapiens (human), Synthetic; S. aureus
  • Promoter mouse U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
  • 3′ sequencing primer ATGCATGGCGGTAATACGGTTAT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The original Sa sgRNA scaffold was a gift from Feng Zhang (MIT) and was modified based on a design by Bo Huang (UCSF).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains a CMV-EGFP fluorescent marker 3' of the sgRNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP was a gift from Stanley Qi (Addgene plasmid # 84254 ; http://n2t.net/addgene:84254 ; RRID:Addgene_84254)
  • For your References section:

    Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111