pSLQ2806-2 pHR: U6-Sasgv2TRE3G CMV-mCherry
(Plasmid
#84250)
-
PurposeExpresses optimized Sa sgTRE3G gRNA with a mCherry fluorescent marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
- Total vector size (bp) 7642
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSa sgTRE3G
-
gRNA/shRNA sequencegttactccctatcagtgata
-
SpeciesSynthetic; S. aureus
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
- 3′ sequencing primer ATGCATGGCGGTAATACGGTTAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe original Sa sgRNA scaffold was a gift from Feng Zhang (MIT) and was modified based on a design by Bo Huang (UCSF).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains a CMV-mCherry fluorescent marker 3' of the sgRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ2806-2 pHR: U6-Sasgv2TRE3G CMV-mCherry was a gift from Stanley Qi (Addgene plasmid # 84250 ; http://n2t.net/addgene:84250 ; RRID:Addgene_84250) -
For your References section:
Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111