pSLQ2814 pPB: CAG-Puro-WPRE PGK-VPR-tagBFP-SpdCas9
(Plasmid #84247)

• Purpose: Expresses direct fusion VPR-Sp dCas9
• Depositing Lab: Stanley Qi
• Publication: Gao et al Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.

Backbone

• Vector backbone: PB
• Backbone manufacturer: System Biosciences
• Total vector size (bp): 13189
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: VPR-tagBFP-Sp dCas9
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 6546
• Promoter: PGK
• Tags / Fusion Proteins:
  • VPR (N terminal on insert)
  • tagBFP (N terminal on insert)
  • HA tag (C terminal on insert)
  • 2xNLS (SV40) (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gaaggtcctccggaggcc
• 3′ sequencing primer: CGGTCTGTATATCGAGGTTTATTTATTAATTTG

Gene/Insert 2

• Gene/Insert name: Puro
• Insert Size (bp): 606
• Promoter: CAG

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tcggcttctggcgtgtga
• 3′ sequencing primer: AAGCAGCGTATCCACATAGC

Resource Information

• Supplemental Documents:
  • pSLQ2814 Annotated GenBank File
• A portion of this plasmid was derived from a plasmid made by: The dCas9 gene was a gift from Martin Jinek and Jennifer Doudna (UC Berkeley).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry