pSLQ2842 pPB: CAG-GID1-VPR-IRES-Zeo-WPRE PGK-GAI-tagBFP-SadCas9
(Plasmid #84244)

• Purpose: Expresses GA-inducible VPR-Sa dCas9
• Depositing Lab: Stanley Qi
• Publication: Gao et al Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.

Backbone

• Vector backbone: PB
• Backbone manufacturer: System Biosciences
• Total vector size (bp): 13933
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: GAI-tagBFP-Sa dCas9
• Alt name: nuclease dead SauCas9
• Species: A. thaliana (mustard weed), Synthetic; S. aureus
• Insert Size (bp): 4275
• Mutation: D10A, N580A
• Promoter: PGK
• Tags / Fusion Proteins:
  • GAI-tagBFP-Nucleoplasmin NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gaaggtcctccggaggcc
• 3′ sequencing primer: CGGTCTGTATATCGAGGTTTATTTATTAATTTG

Gene/Insert 2

• Gene/Insert name: GID1-VPR
• Alt name: VP64-p65-Rta
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 2631
• Mutation: Synonymous mutation in PYL1 to remove XhoI site
• Promoter: CAG
• Tags / Fusion Proteins:
  • GID1 (N terminal on insert)
  • IRES-Zeocin (C terminal on backbone)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: tcggcttctggcgtgtga
• 3′ sequencing primer: gacggcaatatggtggaaaataac

Resource Information

• Supplemental Documents:
  • pSLQ2842 Annotated GenBank File
• A portion of this plasmid was derived from a plasmid made by: The Sa dCas9 gene was a gift from Feng Zhang (MIT). The GAI and GID1 domains were gifts from Takanari Inoue (Johns Hopkins)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry