Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDEW8
(Plasmid #84238)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84238 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p413GPD
  • Backbone size w/o insert (bp) 5771
  • Total vector size (bp) 7372
  • Modifications to backbone
    Insertion of HA-mRuby-p2A-eGFP by gibson cloning
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HA-mRuby-P2A-eGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1601
  • Promoter GPD
  • Tags / Fusion Proteins
    • HA-mRuby (N terminal on insert)
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGCAATTAACCCTCACTAAA
  • 3′ sequencing primer AGGGTTTTCCCAGTCACGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEW8 was a gift from David Weinberg (Addgene plasmid # 84238 ; http://n2t.net/addgene:84238 ; RRID:Addgene_84238)
  • For your References section:

    The fail-safe mechanism of post-transcriptional silencing of unspliced HAC1 mRNA. DiSanto R, Aboulhouda S, Weinberg DE. Elife. 2016 Oct 1;5. pii: e20069. doi: 10.7554/eLife.20069. 10.7554/eLife.20069 PubMed 27692069