pDEW8
(Plasmid #84238)

• Purpose: Plasmid containing a P2A peptide (porcine teschovirus-1 derived) sequence that works efficiently in Saccharomyces cerevisiae
• Depositing Lab: David Weinberg
• Publication: DiSanto et al Elife. 2016 Oct 1;5. pii: e20069. doi: 10.7554/eLife.20069.

Backbone

• Vector backbone: p413GPD
• Backbone size w/o insert (bp): 5771
• Total vector size (bp): 7372
• Modifications to backbone: Insertion of HA-mRuby-p2A-eGFP by gibson cloning
• Vector type: Yeast Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HA-mRuby-P2A-eGFP
• Species: Synthetic
• Insert Size (bp): 1601
• Promoter: GPD
• Tags / Fusion Proteins:
  • HA-mRuby (N terminal on insert)
  • eGFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCGCAATTAACCCTCACTAAA
• 3′ sequencing primer: AGGGTTTTCCCAGTCACGAC

Resource Information

• Supplemental Documents:
  • The fail-safe mechanism of post-transcriptional silencing of unspliced HAC1 mRNA
• A portion of this plasmid was derived from a plasmid made by: mRuby original source was p44888 eGFP original source was p44836

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry