Rhesus AAVS1-CAG-copGFP
(Plasmid #84209)

• Purpose: Rhesus AAVS1 safe harbor gene targeting donor expressing CAG-driven copGFP
• Depositing Lab: Cynthia Dunbar
• Publication: Rhesus AAVS1-CAG-copGFP (unpublished)

Backbone

• Vector backbone: pAAVS1P-iCAG.copGFP (Plasmid #66577)
• Total vector size (bp): 10499
• Modifications to backbone: The human AAVS1 homology arms were replaced with rhesus homologous sequences.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Rhesus AAVS1 5’ homology arm
• Species: rhesus macaque (Macaca mulatta)
• Insert Size (bp): 700
• GenBank ID: N/A (Chromosome 19:61115597-61116296, the MGSC Merged 1.0/rheMac2 assembly)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (destroyed during cloning)
• 3′ cloning site: NotI (destroyed during cloning)
• 5′ sequencing primer: tatgaccatgattacgccgccacctccttcaggttccagcttcct

Gene/Insert 2

• Gene/Insert name: Rhesus AAVS1 3’ homology arm
• Species: rhesus macaque (Macaca mulatta)
• Insert Size (bp): 700
• GenBank ID: N/A (Chromosome 19:61114897-61115596, the MGSC Merged 1.0/rheMac2 assembly)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PmeI (destroyed during cloning)
• 3′ cloning site: PmeI (destroyed during cloning)
• 5′ sequencing primer: agtcagtgagaatattgtttgactggtgacaaaaagccccatcct

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry