pFGC5941-PacI-ath-STTM831
(Plasmid
#84161)
-
Purposetarget miRNA831 for destruction in Arabidopsis thaliana
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFGC5941-PacI
-
Backbone manufacturerGuiliang Tang (Addgene plasmid # 44182)
- Backbone size w/o insert (bp) 8608
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTTM831
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2846
- Promoter 2x35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CACTATCCTTCGCAAGACCCTTCC
- 3′ sequencing primer CAACACATGAGCGAAACCCTATAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert within this plasmid contains a 2x35S promoter, STTM, T35S and CmR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFGC5941-PacI-ath-STTM831 was a gift from Guiliang Tang (Addgene plasmid # 84161 ; http://n2t.net/addgene:84161 ; RRID:Addgene_84161) -
For your References section:
Construction of short tandem target mimic (STTM) to block the functions of plant and animal microRNAs. Tang G, Yan J, Gu Y, Qiao M, Fan R, Mao Y, Tang X. Methods. 2012 Oct;58(2):118-25. doi: 10.1016/j.ymeth.2012.10.006. Epub 2012 Oct 23. 10.1016/j.ymeth.2012.10.006 PubMed 23098881