pHD066
(Plasmid #84032)

• Purpose: Vector for creating transgenic zebrafish. Expresses mCherry-Cre fusion protein under the elastase promoter and Venus under the crystalin promoter in zebrafish
• Depositing Labs: Daniel Hesselson, Didier Stainier
• Publication: Hesselson et al Curr Biol. 2011 Apr 26;21(8):712-7. doi: 10.1016/j.cub.2011.03.041. Epub 2011 Apr 14.

Backbone

• Vector backbone: unknown
• Vector type: Cre/Lox ; Zebrafish transgenesis

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cre
• Promoter: Elastase
• Tag / Fusion Protein:
  • mCherry (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: mCherry-F (ccccgtaatgcagaagaaga)

Gene/Insert 2

• Gene/Insert name: Venus
• Promoter: Crystalin

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: SV40pA-R

Resource Information

• Supplemental Documents:
  • pHD066-map_Depositor-reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Designed in a pBluescript series vector containing I-SceI meganuclease sites. The I-SceI meganuclease method is a common method for establishing transgenic zebrafish lines.
Please note that the Addgene verified sequence differs from the depositor's reference sequence (see supplemental materials above). The following differences do not alter plasmid functions described in the publication:
- 1kb deletion at the 5' end of the elastase promoter
- 2 other single nucleotide mismatches in elastase promoter
- L88K amino acid residue substitution in the mCherry fluor
- f1 origin is in the opposite orientation
- one mismatch in the ColE1 origin.