pRRL_SRSF2_WT_mCherry
(Plasmid #84020)

• Purpose: expression of SRSF2 in mammalian cells
• Depositing Lab: Robert Bradley
• Publication: Kim et al Cancer Cell. 2015 May 11;27(5):617-30. doi: 10.1016/j.ccell.2015.04.006.

Backbone

• Vector backbone: pRRLSIN.cPPT.PGK-GFP.WPRE
• Backbone manufacturer: Didier Trono (Addgene plasmid # 12252)
• Backbone size w/o insert (bp): 6651
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SRSF2
• Species: H. sapiens (human)
• Insert Size (bp): 1458
• Entrez Gene: SRSF2 (a.k.a. PR264, SC-35, SC35, SFRS2, SFRS2A, SRp30b)
• Promoter: PGK
• Tags / Fusion Proteins:
  • Flag (C terminal on insert)
  • 2TA-mCherry (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ggggttggggttgcgccttt (hPGK)
• 3′ sequencing primer: TTACTTGTACAGCTCGTCCA

Resource Information

• Supplemental Documents:
  • annotated sequence
• A portion of this plasmid was derived from a plasmid made by: Aravind Ramakrishnan, FHCRC clinical research division
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry