-
Purposeexpression of mutant U2AF1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRLSIN.cPPT.PGK-GFP.WPRE
-
Backbone manufacturerDidier Trono (Addgene plasmid # 12252)
- Backbone size w/o insert (bp) 6651
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU2AF1
-
Alt nameU2 small nuclear RNA auxiliary factor 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1515
-
MutationS34F
-
Entrez GeneU2AF1 (a.k.a. FP793, RN, RNU2AF1, U2AF35, U2AFBP)
- Promoter PGK
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- T2A-mCherry (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ggggttggggttgcgccttt (hPGK)
- 3′ sequencing primer TTACTTGTACAGCTCGTCCA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAravind Ramakrishnan, FHCRC clinical research division
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL_U2AF1_S34F_mCherry was a gift from Robert Bradley (Addgene plasmid # 84019 ; http://n2t.net/addgene:84019 ; RRID:Addgene_84019) -
For your References section:
U2AF1 mutations alter splice site recognition in hematological malignancies. Ilagan JO, Ramakrishnan A, Hayes B, Murphy ME, Zebari AS, Bradley P, Bradley RK. Genome Res. 2015 Jan;25(1):14-26. doi: 10.1101/gr.181016.114. Epub 2014 Sep 29. 10.1101/gr.181016.114 PubMed 25267526