pRRL_U2AF1_S34Y_mCherry
(Plasmid #84018)

• Purpose: expression of mutant U2AF1 in mammalian cells
• Depositing Lab: Robert Bradley
• Publication: Ilagan et al Genome Res. 2015 Jan;25(1):14-26. doi: 10.1101/gr.181016.114. Epub 2014 Sep 29.

Backbone

• Vector backbone: pRRLSIN.cPPT.PGK-GFP.WPRE
• Backbone manufacturer: Didier Trono (Addgene plasmid # 12252)
• Backbone size w/o insert (bp): 6651
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: U2AF1
• Alt name: U2 small nuclear RNA auxiliary factor 1
• Species: H. sapiens (human)
• Insert Size (bp): 1515
• Mutation: S34Y
• Entrez Gene: U2AF1 (a.k.a. FP793, RN, RNU2AF1, U2AF35, U2AFBP)
• Promoter: PGK
• Tags / Fusion Proteins:
  • FLAG (C terminal on insert)
  • T2A-mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ggggttggggttgcgccttt (hPGK)
• 3′ sequencing primer: TTACTTGTACAGCTCGTCCA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Aravind Ramakrishnan, FHCRC clinical research division

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry