pCFD4d-U6-1:white1-U6-3:white1
(Plasmid #84005)

• Purpose: pCFD4d expresses white sgRNA-1 from a U6:3 promoter and the same white sgRNA-1 from a U6:1 promoter
• Depositing Lab: Phillip Zamore
• Publication: Ge et al G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557.

Backbone

• Vector backbone: pCFD4d
• Backbone size w/o insert (bp): 4575
• Total vector size (bp): 4579
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: white sgRNA-1
• Species: D. melanogaster (fly)
• Insert Size (bp): 20
• Promoter: U6:3

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ATTCCTATCCGGCGGTAGTC
• 3′ sequencing primer: TGTACGTCAACGGAAAACCA

Gene/Insert 2

• Gene/Insert name: white sgRNA-1
• Species: D. melanogaster (fly)
• Insert Size (bp): 20
• Promoter: U6:1

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ATTCCTATCCGGCGGTAGTC
• 3′ sequencing primer: TGTACGTCAACGGAAAACCA

Resource Information

• Supplemental Documents:
  • pCFD4d-U6-1:white1-U6-3:white1 annotated sequence
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry