Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRKB133_GI-DUX4-intron2(+)
(Plasmid #83967)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83967 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    β-globin NMD reporter wild-type
  • Backbone manufacturer
    Lynne Maquat, PMID 9671053
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DUX4-3'UTR-intron2(+)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    956
  • GenBank ID
    FJ439133.1
  • Entrez Gene
    DUX4 (a.k.a. DUX4L)
  • Promoter mouseCMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCTGGCTCACAAGTACCACTAG
  • 3′ sequencing primer AGCATAAACCCTTCTATGACACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRKB133_GI-DUX4-intron2(+) was a gift from Robert Bradley (Addgene plasmid # 83967 ; http://n2t.net/addgene:83967 ; RRID:Addgene_83967)
  • For your References section:

    A feedback loop between nonsense-mediated decay and the retrogene DUX4 in facioscapulohumeral muscular dystrophy. Feng Q, Snider L, Jagannathan S, Tawil R, van der Maarel SM, Tapscott SJ, Bradley RK. Elife. 2015 Jan 7;4. doi: 10.7554/eLife.04996. 10.7554/eLife.04996 PubMed 25564732