pLV-U6-gRNA-UbC-eGFP-P2A-Bsr
(Plasmid #83925)

• Purpose: Lentiviral SpCas9-gRNA expression vector with eGFP-P2A-BlastR
• Depositing Lab: Charles Gersbach
• Publication: Klann et al Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853.

Backbone

• Vector backbone: FUGW
• Total vector size (bp): 15000
• Vector type: Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: eGFP
• Insert Size (bp): 717
• GenBank ID: FJ226077.1
• Promoter: hUbC
• Tag / Fusion Protein:
  • P2A (C terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gttggcgagtgtgttttgtg

Gene/Insert 2

• Gene/Insert name: Bsr
• Alt name: blasticidin-S deaminase from Bacillus cereus
• Insert Size (bp): 422
• Tag / Fusion Protein:
  • P2A (N terminal on insert)

Resource Information

• Supplemental Documents:
  • GenBank File
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Digest with BsmBI to remove ~1.9 kb stuffer for cloning in protospacer sequences.